| February
1998
Knowing the human genetic code unveils new inequalities
|
|
|
All the media hype about cloning obscures some other serious questions
that will arise from the progress of genetic science. Creating carbon
copies of ourselves -- if it ever comes to that -- does not really
present any fundamental difficulty. Our personhood is not based on our
genetic code alone. If it were, identical twins would not be considered
two persons, but one. I have argued this view in "Wandering Sheep"
and I won't repeat the points here.
In any case, I have the feeling that the most likely use of cloning technology would be to replicate spare organs for ourselves, such as a heart or liver, to replace a diseased one. We could even grow beef steaks without ever raising cattle. It would not only be a hell of a lot friendlier to the environment, it would be a tremendous ethical advance in the sense that we wouldn't have to slaughter animals anymore. Hurray for cloning, I say! The really major advance in genetic science that is speeding along in laboratories is the Human Genome Project. Enough progress has been made for us to see where this project is going to lead to. Two or three generations from now, we can expect to have the means to read our individual genetic code. But this information is a double-edged sword. It is going to be of huge medical benefit but it is also going to enable new forms of discrimination. This potential for new inequalities presents big ethical problems which the brouhaha about cloning completely misses. But first, I need to explain some basics about the Human Genome Project and the genetic code.
The Human Genome Project, scheduled for completion in the year 2005, has the aim of reading every single DNA base in our chromosomes. There are only 4 kinds of bases, Adenine, Cytosine, Guanine and Thymine, abbreviated as A, C, G and T, but there are about 6 billion of them in the 23 pairs (or 46) chromosomes that we have. The goal of the Human Genome Project is to read them and to store the data in huge computers. The data will look like this: AGCTGATGAATGGACTAGCGTAGCTGGACCTAAGTCGTAGAT CTTGTAGTACAGGCG Within our cells, our body's chemicals read off the bases in sets of three, hence the above string would be read thus: AGC TGA TGA ATG GAC TAG CGT AGC TGG ACC TAA GTC GTA GAT CTT GTA GTA CAG GCG Generally speaking, each triplet codes for an amino acid, and strings of amino acids make up proteins, the building blocks, enzymes and work agents of our bodies. These 6 billion bases in the human genome are our genetic inheritance; they are the "nature" in the nature/nurture debate on any topic. They determine the original pigmentation in our skin, the shape of our fingernails, the timbre of our voices and the number of folds in our eyelids. The fact that humans have variations in skin colour, fingernail shape and so on, tells you that we do not all share exactly the same code. Each individual has some unique differences among his 6 billion bases. The differences are slight, far less than 1 percent, for -- I'm not too sure where I read this -- the difference between humans and chimpanzees, quite different species altogether, amounts to merely 1 percent of the DNA. The Human Genome Project does not aim to decode the meaning of the strings of bases; it's an enormous enough project just trying to read off the A's, C's, G's and T's. It's purpose is simply to build a data resource for future biologists to refer to. However, parallel to the Human Genome Project, other scientists are making progress in decoding the DNA sequence. Increasingly, we are able to understand which sections of the DNA sequence produce what sorts of proteins, and also what these proteins do in our bodies. Already, biologists understand exactly which genetic errors lead to faulty Factor VIII and Factor IX proteins in blood, and how these faulty proteins cause hemophilia. They also understand in detail the cascade of errors that lead to cystic fibrosis, sickle cell anemia, and are close to homing in on colour blindness, among hundreds, if not thousands, of other conditions. Here again, I am sanguine. If such progress in genetic science leads to a cure for these diseases and conditions, no sensible person should quarrel with it.
|
||
|
But the early successes in finding the genetic causes of diseases were the easy ones to decode. This is because these conditions have a direct linkage between a section of the DNA code, a few proteins and the observable condition. Current indications are that most other features of our human biology are more complex, they are indirect. Our genetic inheritance merely gives us a susceptibility to something, like stomach cancer, or allergies to seafood. They may predispose us to brain hemorrhage or flat feet. Other factors, environmental, behavioural, lifestyle ones, are needed to trigger off the condition, and this may happen decades after birth. It's like inborn talent. It's there, but it needs a lot more input from "nurture" before it becomes anything of substance.
Talking about inborn talent, most people who are familiar with the work going on are expecting that we will soon find a genetic basis for talent. The strings of DNA will turn out to give us much more than our physiological make-up. We will soon discover that, like talent, intelligence, personality and temperament are in our genes too, almost certainly one of the "indirects". It has been estimated that as much as 70% of intelligence is inherited, 30% taught. I suspect however that "intelligence" here means mathematical/logical intelligence, not the other 6 or 7 kinds like verbal/linguistic or spatial intelligence. However, this limitation does not mean these other kinds of intelligence aren't largely inherited either. It goes against the grain of political correctness today to say that people are born stupid or inarticulate, but I think this is what we are going to find before too long. It's easy to believe these failings are due to inadequate education, or some shortcoming in the family or school environment, or sheer laziness on the part of the individual to improve himself, but for now, it's Belief. The more we find out about our DNA, the more it looks as if Belief is at least partly wrong, that more than maybe, people are born stupid or poor in communication. The implications of this I will come to in a moment. Moving on, we're also going to have to deal with the very real possibility that our genes may predispose us to certain kinds of temperaments, like a tendency to angry outbursts, or remaining calm in a crisis, or just being the perennial optimist, or the type that is generally submissive to authority. Whether one is a loner, or a team player may be partly in our genes. When you start thinking about it, lots of other traits are likely to be part of the genetic inheritance, at least indirectly. There are capabilities we have observed in others around us, which we have never been able to explain in terms of any particular training or upbringing, but some people are just good at these things. For example, an ability to pick up foreign languages easily, or to orient oneself and find one's way around in a new city, or the flair in mixing and matching colours. Even things we don't ever consider as linked to DNA today are likely to turn out to be so, for example, a tendency to religiosity. You can put people on a scale ranging from devout to sceptic. What makes you think this aspect of our personality is only due to upbringing and life experiences, that is, the nurture part of the nature/nurture mix? In short, when the human genetic sequence is substantially decoded -- and this may be just 30-50 years away -- all these attributes and predispositions, to disease, to temperament and to talent or the lack of talent, will be knowable well before they manifest themselves. Employers can require a DNA read-out before they hire you. If your DNA shows an anti-authoritarian streak or a lack of collegiality, you may be severely disadvantaged for most jobs. If you have a predisposition for a serious ilness, you may never get medical insurance. This opens the door to new kinds of discrimination just when most societies are making headway against race and sex discrimination. New types of underclasses and societal rejects will result, and they will trouble our social conscience. At least I hope they will trouble our conscience; if they don't, then I shall despair.
In the modern age, we believe that some degree of equality is essential for social peace, and as a moral good in itself. Without the notion of equality, the notion of justice is unintelligible. (Consider this: we think of justice between humans, we don't think of justice between humans and elephants). So we cannot simply shrug our shoulders at the new inequalities and say that's too bad, that's the way the future is. If we don't address ourselves to the issue, we let our ideal of equality rot, and with it the ideal of justice. Of course, we know we cannot take equality to an extreme. It is plainly impractical and detrimental to human liberty to try to make each and every individual absolutely equal in things like income, health, housing or happinness. We strike the balance through the concept of equality of opportunity, but this concept is founded on the divide between the "givens" for any person, and the things he can be responsible for. "Givens" would include his genetic inheritance, but also the social class he is born into. A lot of public policy today is directed at compensating for the disadvantages in the "givens" for some in the population, so that we can have as level a playing field as possible. From this starting premise, we create anti-discrimination laws, even affirmative action. We provide free education, so that poorer families can have more or less equal access to it. We award bursaries and scholarships to deserving students, and we provide subsidised medical care to the needy. What the person then does after being given a reasonably equal starting point is up to him. He can succeed in life or become a bum; we don't guarantee the result, only the equality of opportunity. Our conscience is clear. This principle is sound, but how we can apply it to the future inequalities is less easy than it looks. I shall explore three broad areas: employment, medical care and education. Most people would agree that these three areas are fundamental to our ideas of social equity.
I have alluded to the scenario above. Employers may insist on a DNA profile before hiring. If your DNA profile shows you to be predisposed to be rebellious in nature, or prone to obsessive or addictive habits (yes, what will happen to the justification for our social and criminal policies if we find that the tendency to alcoholism or smoking is in our genes?), or a loner, or gay, then you may well be disadvantaged for most jobs. The obvious solution is to tighten privacy laws -- not that Singapore even has a prototype privacy law at the moment! -- to make it illegal to request for DNA profiles. This move will require all employers not to prejudge enmployees, but push them to evaluate them on actual performance as they do now. Yet, it isn't so easy either. Why shouldn't employers of the future be given the best shot at getting the kinds of employees they need (or think they need)? How are businesses in one country with a stout privacy law going to compete with businesses in other countries that can pick and choose their employees based on DNA profiles?
Essentially, there are three basic ways in which medical care is paid for. Firstly, pay out of your own pocket; secondly, paid for by the State, though usually this would have tight limits on eligibility and scope; thirdly, through insurance. Medical insurance comes in various forms, sometimes through the employer, sometimes taken out personally. Singapore's CPF-Medishield scheme is also a form of insurance. At the risk of oversimplification, what insurance does is to pool the cost. The insurer determines what the average risk and therefore average cost is, and everyone who is insured pays this amount. What an individual actually draws out of the system depends on what actually happens to him, the type of illness he suffers, and the kinds of treatment he needs. The system works when risk is knowable on a pooled basis -- that's what actuary is about -- but the final outcome on a person to person basis is not knowable. The system breaks down when the future outcome for the individual, presently the unknown part of the equation, becomes a lot more knowable. A person strongly predisposed to heart disease and a shorter life will be disadvantaged; he will be asked to pay a higher premium. Worse yet, there are some diseases coded by our genes which are sure things, not merely predispositions. It's just that the onset of the disease appears later in life. One example is Huntingdon's Chorea, which shows up in a person's thirties or forties and kills by the fifties. When your genes have Huntingdon's Chorea, you will get it. The risk is 100%. How do you think insurers will handle diseases like that? Simple, they won't insure. And this is precisely for the person who needs to cover medical costs most. So, should it be illegal for insurers to require DNA profiles? It's not a bad idea, as it holds insurance to its basic concept of averaging on a pooled basis. But what if individuals who know they have good genes, offer to reveal their DNA profiles to the insurers to get a discount? Economics will then lead to a situation where those who don't offer their DNA profiles will generally pay higher premiums. In any case, the pure rule is already being violated, even today. Premiums are higher for people with known risks, such as smokers. If we are not purists now, what's the point of being purists in the future? Furthermore, do we want this degree of government control over private business like insurance? On the other hand, one can argue that the whole area of medical insurance a matter of social interest for the community, that justifies this degree of intervention. These are the complicated issues raised by the new technology, and they are not just in the future. They point to the fact that even today, we have not thought through very well the entire issue of how to bear or share medical costs. We didn't need to do that before when the State paid most of the medical bills -- in that sense, the State was the insurer who asked no questions -- but medical care is being privatised so rapidly and with escalating costs in Singapore, that we cannot afford not to start thinking about this subject seeing that it will get even more tangled soon enough.
I talked about people being born stupid. OK, that was an extreme exaggeration to make a point. But there really are differences in aptitude and intelligence, and is should surprise no one if the genes have a lot to do with it. However, before we discuss the issues of the future, we can look at how our present system handles inborn inequalities. Actually, it's very simple. The present system simply pretends there are no inborn inequalities, and implicitly assumes that everything that counts can be taught. Primary education comes in a standard package, and for most, at a standard pace. Secondary education is not a lot less homogenised. If the child fails, our social conscience is not troubled. We have given him an equal shot, except that he didn't make an equal effort. The present system can get away with pretending that there are no inborn inequalities, because till now, there hasn't been good evidence exactly what the inequalities are, and whom they affect. The forthcoming DNA data will change all that. Yet even now, if we look very closely, we can detect the nonsense inherent in the pretence. What, for example, does the standard education package do for dyslexics? And don't tell me dyslexia is not a given precondition for some unfortunate children. Or for that matter, look at how a second language (not just any second language, but one linked to your race!) is a matriculation condition for Singapore universities, regardless of the proposed course of study. What if innate ability to acquire a foreign language is variable from teenager to teenager? Does not the policy discriminate against some?
Then when DNA work reveals these and other genetically-programmed
abilities, we will have a lot of rethinking and re-engineering to do
with our education systems in order to salve our conscience that we have
treated each other equally. It's going to be mind-boggling coming up
with combinations and permutations that cater to the huge diversity of
talent. Or else, we can suppress our conscience and say, too bad, the
harsh fact of economic life is that certain skills matter, and however
disadvantaged your starting point in life, you have to have the same
attainments. That's a valid point too. But if we go that way, to what
extent will it erode our sense of humanity, and to what extent will that
deliberate disavowal of equality (disavowing even any obligation to
create equality of opportunity) hollow out our ideal of equal justice
for all? © Yawning Bread
|
|
|
|
Footnotes None Addenda None
|
|
